o Rŀgh?@sdZddlZGdddZdS)a Print the results of restriction enzyme analysis. PrintFormat prints the results from restriction analysis in 3 different format: list, column or map. The easiest way to use it is: >>> from Bio.Restriction.PrintFormat import PrintFormat >>> from Bio.Restriction.Restriction import RestrictionBatch >>> from Bio.Seq import Seq >>> pBs_mcs = Seq('GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTC') >>> restriction_batch = RestrictionBatch(['EcoRI', 'BamHI', 'ApaI']) >>> result = restriction_batch.search(pBs_mcs) >>> my_map = PrintFormat() >>> my_map.print_that(result, 'My pBluescript mcs analysis:\n', ... 'No site:\n') My pBluescript mcs analysis: ApaI : 12. EcoRI : 50. No site: BamHI >>> my_map.sequence = pBs_mcs >>> my_map.print_as("map") >>> my_map.print_that(result) 12 ApaI | | 50 EcoRI | | GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTC |||||||||||||||||||||||||||||||||||||||||||||||||||||| CCATGGCCCGGGGGGGAGCTCCAGCTGCCATAGCTATTCGAACTATAGCTTAAG 1 54 Enzymes which do not cut the sequence. BamHI >>> Some of the methods of PrintFormat are meant to be overridden by derived class. Use the following parameters to control the appearance: - ConsoleWidth : width of the console used default to 80. should never be less than 60. - NameWidth : space attributed to the name in PrintList method. - Indent : Indent of the second line. - MaxSize : Maximal size of the sequence (default=6: -> 99 999 bp + 1 trailing ',' people are unlikely to ask for restriction map of sequences bigger than 100.000 bp. This is needed to determine the space to be reserved for sites location. - MaxSize = 5 => 9.999 bp - MaxSize = 6 => 99.999 bp - MaxSize = 7 => 999.999 bp Example output:: <------------ ConsoleWidth ---------------> <- NameWidth -> EcoRI : 1, 45, 50, 300, 400, 650, 700, 1200, 2500. <--> Indent Nc@seZdZdZdZdZdZeeZeeZdZ eeZ d$ddZ d%d d Z d%d d Z d&ddZddZddZddZddZd'ddZd'ddZd'ddZd'dd Zd!d"Zd#S)( PrintFormatzBPrintFormat allow the printing of results of restriction analysis.P listcCs4|dkr |j|_dS|dkr|j|_dS|j|_dS)aLPrint the results as specified. Valid format are: 'list' -> alphabetical order 'number' -> number of sites in the sequence 'map' -> a map representation of the sequence with the sites. If you want more flexibility over-ride the virtual method make_format. mapnumberN) _make_map make_format _make_number _make_list)selfwhatrO/var/www/html/myenv/lib/python3.10/site-packages/Bio/Restriction/PrintFormat.pyprint_as`s    zPrintFormat.print_ascCsT|s|j}gg}}|D]\}}|r|||fq||q|||||S)aSummarise results as a nicely formatted string. Arguments: - dct is a dictionary as returned by a RestrictionBatch.search() - title is the title of the map. It must be a formatted string, i.e. you must include the line break. - s1 is the title separating the list of enzymes that have sites from those without sites. - s1 must be a formatted string as well. The format of print_that is a list. )resultsitemsappendr )rdcttitles1lsnckvrrr format_outputqs   zPrintFormat.format_outputcCst||||dS)a*Print the output of the format_output method (OBSOLETE). Arguments: - dct is a dictionary as returned by a RestrictionBatch.search() - title is the title of the map. It must be a formatted string, i.e. you must include the line break. - s1 is the title separating the list of enzymes that have sites from those without sites. - s1 must be a formatted string as well. This method prints the output of A.format_output() and it is here for backwards compatibility. N)printr)rrrrrrr print_thatszPrintFormat.print_thatrcCs|||||S)zVirtual method used for formatting results. Virtual method. Here to be pointed to one of the _make_* methods. You can as well create a new method and point make_format to it. )r )rcutrrrrrrr szPrintFormat.make_formatcC||||||S)aSummarise a list of positions by enzyme (PRIVATE). Return a string of form:: title. enzyme1 : position1, position2. enzyme2 : position1, position2, position3. Arguments: - ls is a tuple or list of cutting enzymes. - title is the title. - nc is a tuple or list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. )_make_list_only_make_nocut_onlyrrrrrrrrr szPrintFormat._make_listcCr")aSummarise mapping information as a string (PRIVATE). Return a string of form:: | title. | | enzyme1, position | | | AAAAAAAAAAAAAAAAAAAAA... | ||||||||||||||||||||| | TTTTTTTTTTTTTTTTTTTTT... Arguments: - ls is a list of cutting enzymes. - title is the title. - nc is a list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. )_make_map_onlyr$r%rrrr szPrintFormat._make_mapcCr")aFormat cutting position information as a string (PRIVATE). Returns a string in the form:: title. enzyme which cut 1 time: enzyme1 : position1. enzyme which cut 2 times: enzyme2 : position1, position2. ... Arguments: - ls is a list of cutting enzymes. - title is the title. - nc is a list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. )_make_number_onlyr$r%rrrr szPrintFormat._make_numbercCs||||S)aSummarise non-cutting enzymes (PRIVATE). Return a formatted string of the non cutting enzymes. ls is a list of cutting enzymes -> will not be used. Here for compatibility with make_format. Arguments: - title is the title. - nc is a list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. )r$r%rrr _make_nocuts zPrintFormat._make_nocutc Cst|s|Sd}|p d}dj}t|D]}||tt||jf}t||jkr0|||df}d}q|||df}|S)zSummarise non-cutting enzymes (PRIVATE). Return a formatted string of the non cutting enzymes. Arguments: - nc is a tuple or list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. rz, Enzymes which do not cut the sequence.  )joinsortedstrljust NameWidthlenlinesize) rrrrrst stringsiteJoinkeyrrrr$s  zPrintFormat._make_nocut_onlycCs|s|S|||S)aSummarise list of positions per enzyme (PRIVATE). Return a string of form:: title. enzyme1 : position1, position2. enzyme2 : position1, position2, position3. ... Arguments: - ls is a tuple or list of results. - title is a string. - Non cutting enzymes are not included. )_PrintFormat__next_sectionr%rrrr#s zPrintFormat._make_list_onlyc Cs|s|S|jdddt|}d}g}|D](\}} t| } | |kr7|d|7}|||}|| fg| }}q||| fq|d|7}|||S)aSummarise number of cuts as a string (PRIVATE). Return a string of form:: title. enzyme which cut 1 time: enzyme1 : position1. enzyme which cut 2 times: enzyme2 : position1, position2. ... Arguments: - ls is a list of results. - title is a string. - Non cutting enzymes are not included. cSs t|dS)N)r/)xrrr2s z/PrintFormat._make_number_only..)r4r6z enzymes which cut %i times : )sortiterr/r5r) rrrrriteratorcur_lennew_sectnamesiteslengthrrrr's      zPrintFormat._make_number_onlyc" Csz|s|Stdd|D}|pd}i}|D]\}} | D]} | |vr+|| t|qt|g|| <qqt|} i} ddt|j} }}td|dD]$} | d}g}|| |<g}| D]}|| kri||q]||q]|} qM| | | <t|j}t|j}d}d\}}d}dj}td|dD]}|d}|}| |D]}d}||kr||D] }d ||f}q|dd }||t||d f}|||d f}|||f}|||f}nR||D] }d ||f}q|d} ||d| d t||d f}||d| d ||| d f}||d| d ||| d d f}|||f}|||f}qd ||||d||||t t|d ddt t|ddff}!|||!f}qd}| |D]}d}||kr||D] }||d |f}qm|d|d }||t||d f}|||d f}|||f}|||f}nT||D] }||d |f}q|d} ||d| d t||d f}||d| d ||| d f}||d| d ||| d d f}|||f}|||f}q`d}!||||d f}!||!|||d f}!||!|||d f}!||!|t t|d dd ||dt t|ddff}!|||!f}|S)aMake string describing cutting map (PRIVATE). Return a string of form:: | title. | | enzyme1, position | | | AAAAAAAAAAAAAAAAAAAAA... | ||||||||||||||||||||| | TTTTTTTTTTTTTTTTTTTTT... Arguments: - ls is a list of results. - title is a string. - Non cutting enzymes are not included. css|] \}}t|VqdSNr,).0r7yrrr Usz-PrintFormat._make_map_only..rr<|)rrz<  ;r)r6Nz z ) r+rr,keysr/sequencerange complementr*r-rjust)"rrrrr resultKeysr enzymemapenzymer!cmappingcutlocr7counterr@loc remainingr4rM revsequenceabase emptyliner3linesnchunklineoline2linetotrmapunitrrrr&As            "$          "$  zPrintFormat._make_map_onlyc Csd|j|jd}|j|j}td|}ddj}}t|D]<\}} d} |ddd| Ddf} t| |krLd d t || D} || } n| } ||t | |jd | df}q!|S) aNext section (PRIVATE). Arguments: - ls is a tuple/list of tuple (string, [int, int]). - into is a string to which the formatted ls will be added. Format ls as a string of lines: The form is:: enzyme1 : position1. enzyme2 : position2, position3. then add the formatted ls to tot return tot. r)rHz([\w,\s()]){1,%i}[,\.]rz, css|]}t|VqdSrArB)rCsiterrrrEsz-PrintFormat.__next_section...cSsg|]}|qSr)group)rCr7rrr sz.PrintFormat.__next_section..z : ) r.Indentr0MaxSizerecompiler*r+r/finditerr,r-) rrinto indentationr0patseveralr3r>r?r2outputrrr__next_sections    zPrintFormat.__next_sectionN)r)rr)rrrr)rr)__name__ __module__ __qualname____doc__ ConsoleWidthr.rkCmodulo PrefWidthrjr0rrr r r r r r(r$r#r'r&r5rrrrrUs.         & r)rxrlrrrrrs H